Product Details
- SNP ID
-
rs9724957
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
36
- Location
-
Chr.1:1176929 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- GGCTCTCTGAGGGGTCCTGTCTCCA[C/T]CACCCCAGCCTTTTCCAGGCTGGTT
- Phenotype
-
MIM: 612090
MIM: 612091
MIM: 612094
- Polymorphism
- C/T, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
MIR200A
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs144945384] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- MIR200A
- Gene Name
- microRNA 200a
There are no transcripts associated with this gene.
- Gene
- MIR200B
- Gene Name
- microRNA 200b
There are no transcripts associated with this gene.
- Gene
- MIR429
- Gene Name
- microRNA 429
There are no transcripts associated with this gene.
- Gene
- TTLL10
- Gene Name
- tubulin tyrosine ligase like 10
- Gene
- TTLL10-AS1
- Gene Name
- TTLL10 antisense RNA 1
There are no transcripts associated with this gene.
View Full Product Details