Product Details

SNP ID: rs450262
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.12:56998081 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TGAAAAAGACTTTCCTCTCTTGTCC[A/C]AACACAAAAAAGCAAGCCAAGATCT
Phenotype: MIM: 605307
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: GPR182 PubMed Links

Gene Details

Gene: GPR182
Gene Name: G protein-coupled receptor 182

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_007264.3	2612	Intron			NP_009195.1
XM_011537824.2	2612	UTR 3			XP_011536126.1
XM_011537825.2	2612	Intron			XP_011536127.1
XM_011537827.2	2612	Intron			XP_011536129.1

Gene: HBCBP
Gene Name: HBcAg-binding protein

There are no transcripts associated with this gene.

Gene: ZBTB39
Gene Name: zinc finger and BTB domain containing 39

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_014830.2	2612	Intron			NP_055645.1

View Full Product Details