Product Details

SNP ID

rs60986317

Assay Type

DME

NCBI dbSNP Submissions

NA

Location

Chr.13:51934853 on Build GRCh38

Set Membership

DME Validated Inventoried

Context Sequence [VIC/FAM]

GCTGTGCCGAGATGGCTTGTCGGAC[A/G]TCAGGGAGGACAGCGACACCTGGCT

Phenotype

MIM: 606882

Polymorphism

A/G, Transition substitution

Allele Nomenclature

Literature Links

ATP7B PubMed Links

Additional Information

For this assay, SNP(s) [rs116091486] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

ATP7B

Gene Name

ATPase copper transporting beta

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_000053.3	3837	Missense Mutation	ACG,ATG	T1434M	NP_000044.2
NM_001005918.2	3837	Missense Mutation	ACG,ATG	T1227M	NP_001005918.1
NM_001243182.1	3837	Missense Mutation	ACG,ATG	T1323M	NP_001230111.1
XM_005266423.2	3837	Missense Mutation	ACG,ATG	T1402M	XP_005266480.1
XM_005266424.4	3837	Missense Mutation	ACG,ATG	T1402M	XP_005266481.1
XM_005266427.2	3837	Missense Mutation	ACG,ATG	T1356M	XP_005266484.1
XM_005266428.1	3837	Missense Mutation	ACG,ATG	T1350M	XP_005266485.1
XM_005266430.4	3837	Missense Mutation	ACG,ATG	T1434M	XP_005266487.1
XM_005266431.3	3837	Missense Mutation	ACG,ATG	T1422M	XP_005266488.1
XM_005266432.2	3837	Missense Mutation	ACG,ATG	T1272M	XP_005266489.1
XM_006719837.3	3837	Missense Mutation	ACG,ATG	T1402M	XP_006719900.1
XM_006719838.1	3837	Missense Mutation	ACG,ATG	T706M	XP_006719901.1
XM_006719839.1	3837	Missense Mutation	ACG,ATG	T645M	XP_006719902.1
XM_011535117.2	3837	Missense Mutation	ACG,ATG	T1402M	XP_011533419.1
XM_011535118.1	3837	Missense Mutation	ACG,ATG	T1389M	XP_011533420.1
XM_011535119.1	3837	Missense Mutation	ACG,ATG	T1373M	XP_011533421.1
XM_011535122.2	3837	Missense Mutation	ACG,ATG	T990M	XP_011533424.1
XM_017020627.1	3837	Missense Mutation	ACG,ATG	T1402M	XP_016876116.1
XM_017020628.1	3837	Missense Mutation	ACG,ATG	T990M	XP_016876117.1

View Full Product Details