Product Details

SNP ID: rs337387
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.5:177520403 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CCAGTCCCAGGATCCTGACAAGGTG[T/G]GGGACAATCCTTGAGTAGATCCAGC
Phenotype: MIM: 608170 MIM: 611435 MIM: 615813
Polymorphism: T/G, Transversion substitution
Allele Nomenclature
Literature Links: DDX41 PubMed Links

Gene Details

Gene: DDX41
Gene Name: DEAD-box helicase 41

There are no transcripts associated with this gene.

Gene: DOK3
Gene Name: docking protein 3

There are no transcripts associated with this gene.

Gene: FAM193B
Gene Name: family with sequence similarity 193 member B

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001190946.2		Intron			NP_001177875.1
XM_006714875.2		Intron			XP_006714938.1
XM_006714876.1		Intron			XP_006714939.1
XM_006714878.1		Intron			XP_006714941.1
XM_006714879.3		Intron			XP_006714942.1
XM_006714880.1		Intron			XP_006714943.1
XM_006714884.1		Intron			XP_006714947.1
XM_006714885.1		Intron			XP_006714948.1
XM_006714886.2		Intron			XP_006714949.1
XM_011534572.1		Intron			XP_011532874.1
XM_011534573.1		Intron			XP_011532875.1
XM_011534574.1		Intron			XP_011532876.1
XM_011534579.2		Intron			XP_011532881.1
XM_011534580.1		Intron			XP_011532882.1
XM_011534581.1		Intron			XP_011532883.1
XM_011534582.1		Intron			XP_011532884.1
XM_011534583.1		Intron			XP_011532885.1

View Full Product Details