Product Details

SNP ID
rs149479181
Assay Type
Functionally Tested
NCBI dbSNP Submissions
NA
Location
Chr.2:88174817 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
ACTTCCTGGAGAAGAGGGAGAAGCA[C/T]GTCACTGTGGTTGTAGGTGTGTTTT
Phenotype
MIM: 611261
Polymorphism
C/T, Transition Substitution
Allele Nomenclature
Literature Links
THNSL2 PubMed Links
Additional Information
For this assay, SNP(s) [rs2139100] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
THNSL2
Gene Name
threonine synthase like 2
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001244676.1 2315 Silent Mutation CAC,CAT H134H NP_001231605.1
NM_001244678.1 2315 Intron NP_001231607.1
NM_018271.4 2315 Silent Mutation CAC,CAT H134H NP_060741.3
XM_005264400.4 2315 Silent Mutation CAC,CAT H134H XP_005264457.1
XM_005264401.4 2315 Silent Mutation CAC,CAT H134H XP_005264458.1
XM_005264402.3 2315 Silent Mutation CAC,CAT H134H XP_005264459.1
XM_005264403.4 2315 Silent Mutation CAC,CAT H134H XP_005264460.1
XM_005264405.4 2315 Silent Mutation CAC,CAT H134H XP_005264462.1
XM_006712041.3 2315 Silent Mutation CAC,CAT H134H XP_006712104.1
XM_006712042.3 2315 Silent Mutation CAC,CAT H134H XP_006712105.1
XM_006712043.2 2315 Silent Mutation CAC,CAT H134H XP_006712106.1
XM_006712044.3 2315 Silent Mutation CAC,CAT H134H XP_006712107.1
XM_011532953.2 2315 Silent Mutation CAC,CAT H134H XP_011531255.1
XM_011532954.2 2315 Intron XP_011531256.1
XM_011532955.2 2315 UTR 5 XP_011531257.1

View Full Product Details