Product Details

SNP ID: rs201374747
Assay Type: Functionally tested
NCBI dbSNP Submissions: 12
Location: Chr.1:1337985 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGGGGCGGCGTTCTCACCTTCACTC[C/T]GCTGACTCCCGGTGCTGCCGCTGCC
Phenotype: MIM: 615467 MIM: 601365 MIM: 605865
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: CPTP PubMed Links

Gene Details

Gene: CPTP
Gene Name: ceramide-1-phosphate transfer protein

There are no transcripts associated with this gene.

Gene: DVL1
Gene Name: dishevelled segment polarity protein 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_004421.2	1783	Missense Mutation			NP_004412.2
XM_005244731.3	1783	Missense Mutation			XP_005244788.1
XM_005244732.3	1783	Missense Mutation			XP_005244789.1
XM_005244733.3	1783	Missense Mutation			XP_005244790.1

Gene: MIR6808
Gene Name: microRNA 6808

There are no transcripts associated with this gene.

Gene: TAS1R3
Gene Name: taste 1 receptor member 3

There are no transcripts associated with this gene.

View Full Product Details