Product Details

SNP ID: rs201545588
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.2:27373938 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ACGGGCAGAAAGTTCTGGTCAACGT[A/G]CTAACTTCAGATCAGACTGAGGATG
Phenotype: MIM: 606687 MIM: 605119 MIM: 605963 MIM: 613598
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: EIF2B4 PubMed Links

Gene Details

Gene: EIF2B4
Gene Name: eukaryotic translation initiation factor 2B subunit delta

There are no transcripts associated with this gene.

Gene: PPM1G
Gene Name: protein phosphatase, Mg2+/Mn2+ dependent 1G

There are no transcripts associated with this gene.

Gene: SNX17
Gene Name: sorting nexin 17

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001267059.1	421	Silent Mutation	GTA,GTG	V121V	NP_001253988.1
NM_001267060.1	421	Silent Mutation	GTA,GTG	V108V	NP_001253989.1
NM_001267061.1	421	Silent Mutation	GTA,GTG	V113V	NP_001253990.1
NM_014748.3	421	Silent Mutation	GTA,GTG	V133V	NP_055563.1
XM_011533203.1	421	UTR 5			XP_011531505.1
XM_017005405.1	421	UTR 5			XP_016860894.1

Gene: ZNF513
Gene Name: zinc finger protein 513

There are no transcripts associated with this gene.

View Full Product Details