Product Details

SNP ID: rs79730308
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.14:23310496 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCTAGAATGTGGCAACGTAGTTGTG[C/T]TCGCCAGAACGTGGGACCAAATTGG
Phenotype: MIM: 601931 MIM: 602279
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: BCL2L2 PubMed Links

Gene Details

Gene: BCL2L2
Gene Name: BCL2 like 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001199839.1	2297	UTR 3			NP_001186768.1
NM_004050.4	2297	UTR 3			NP_004041.1

Gene: BCL2L2-PABPN1
Gene Name: BCL2L2-PABPN1 readthrough

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001199864.1	2297	Intron			NP_001186793.1

Gene: PABPN1
Gene Name: poly(A) binding protein nuclear 1

There are no transcripts associated with this gene.

Gene: PPP1R3E
Gene Name: protein phosphatase 1 regulatory subunit 3E

There are no transcripts associated with this gene.

View Full Product Details