Product Details

SNP ID
rs74707053
Assay Type
Functionally Tested
NCBI dbSNP Submissions
NA
Location
Chr.5:96666183 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
CACCTATAAAGCTAGTCAGTGAAAC[G/T]TTGCAATGTATATTTCCACATTGAA
Phenotype
MIM: 114090
Polymorphism
G/T, Transversion Substitution
Allele Nomenclature
Literature Links
CAST PubMed Links
Additional Information
For this assay, SNP(s) [rs137971293] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
CAST
Gene Name
calpastatin
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001190442.1 Intron NP_001177371.1
XM_006714696.3 Intron XP_006714759.1
XM_006714697.3 Intron XP_006714760.1
XM_006714698.3 Intron XP_006714761.1
XM_006714699.3 Intron XP_006714762.1
XM_006714700.3 Intron XP_006714763.1
XM_006714701.3 Intron XP_006714764.1
XM_006714702.3 Intron XP_006714765.1
XM_006714703.3 Intron XP_006714766.1
XM_006714704.3 Intron XP_006714767.1
XM_006714705.3 Intron XP_006714768.1
XM_006714706.3 Intron XP_006714769.1
XM_006714707.3 Intron XP_006714770.1
XM_006714708.3 Intron XP_006714771.1
XM_006714709.3 Intron XP_006714772.1
XM_006714710.3 Intron XP_006714773.1
XM_006714711.3 Intron XP_006714774.1
XM_006714712.3 Intron XP_006714775.1
XM_006714713.3 Intron XP_006714776.1
XM_006714714.3 Intron XP_006714777.1
XM_006714715.3 Intron XP_006714778.1
XM_011543654.2 Intron XP_011541956.1
XM_011543655.2 Intron XP_011541957.1
XM_011543656.2 Intron XP_011541958.1
XM_011543657.2 Intron XP_011541959.1
XM_011543658.2 Intron XP_011541960.1
XM_017009911.1 Intron XP_016865400.1
XM_017009912.1 Intron XP_016865401.1
XM_017009913.1 Intron XP_016865402.1
XM_017009914.1 Intron XP_016865403.1
XM_017009915.1 Intron XP_016865404.1
XM_017009916.1 Intron XP_016865405.1
XM_017009917.1 Intron XP_016865406.1
XM_017009918.1 Intron XP_016865407.1
XM_017009919.1 Intron XP_016865408.1
XM_017009920.1 Intron XP_016865409.1
XM_017009921.1 Intron XP_016865410.1
XM_017009922.1 Intron XP_016865411.1
XM_017009923.1 Intron XP_016865412.1
XM_017009924.1 Intron XP_016865413.1
XM_017009925.1 Intron XP_016865414.1
XM_017009926.1 Intron XP_016865415.1
XM_017009927.1 Intron XP_016865416.1
XM_017009928.1 Intron XP_016865417.1
XM_017009929.1 Intron XP_016865418.1
XM_017009930.1 Intron XP_016865419.1
XM_017009931.1 Intron XP_016865420.1
XM_017009932.1 Intron XP_016865421.1

View Full Product Details