Product Details
- SNP ID
-
rs112886802
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.19:32976508 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- GGGCCCTGCTGCTGTCTGAGCCTTC[C/G]CTCCTTCGAACCGTGCAGCAGATCC
- Phenotype
-
MIM: 615470
MIM: 610884
- Polymorphism
- C/G, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
CEP89
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs2304103] are located under a probe and SNP(s) [rs2304102] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- CEP89
- Gene Name
- centrosomal protein 89
There are no transcripts associated with this gene.
- Gene
- FAAP24
- Gene Name
- Fanconi anemia core complex associated protein 24
- Gene
- RHPN2
- Gene Name
- rhophilin Rho GTPase binding protein 2
There are no transcripts associated with this gene.
View Full Product Details