Product Details

SNP ID: rs113988439
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.22:21000027 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ACCGCAGCCGCTGCTCCCGCCGCTT[C/G]CAGGCCTGCAGCTGGCGCTGGGCCT
Phenotype: MIM: 600574 MIM: 608077 MIM: 609518
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: LZTR1 PubMed Links

Gene Details

Gene: LZTR1
Gene Name: leucine zipper like transcription regulator 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_006767.3	987	Intron			NP_006758.2

Gene: P2RX6
Gene Name: purinergic receptor P2X 6

There are no transcripts associated with this gene.

Gene: THAP7
Gene Name: THAP domain containing 7

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001008695.1	987	Missense Mutation	TGC,TGG	C261W	NP_001008695.1
NM_030573.2	987	Missense Mutation	TGC,TGG	C261W	NP_085050.2

Gene: THAP7-AS1
Gene Name: THAP7 antisense RNA 1

There are no transcripts associated with this gene.

Gene: TUBA3FP
Gene Name: tubulin alpha 3f pseudogene

There are no transcripts associated with this gene.

View Full Product Details