Product Details
- SNP ID
-
rs112428421
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.13:112069435 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- GGGTTTTGTAAAACTTTATGTATCT[C/G]AGCATTTCCATTTTTTTTTTTGGGT
- Phenotype
-
MIM: 602148
- Polymorphism
- C/G, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
LINC00403
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs112744108] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- LINC00403
- Gene Name
- long intergenic non-protein coding RNA 403
There are no transcripts associated with this gene.
- Gene
- SOX1
- Gene Name
- SRY-box 1
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_005986.2 |
1837 |
UTR 3 |
|
|
NP_005977.2 |
View Full Product Details