Product Details

SNP ID: rs141223463
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:67487111 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGAGCTCATCATTGGCAAGAAGTTC[A/G]AGCTGCCTGTGTGGGAGACCATCGT
Phenotype: MIM: 605555 MIM: 608794
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: AIP PubMed Links

Gene Details

Gene: AIP
Gene Name: aryl hydrocarbon receptor interacting protein

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001302959.1	335	Missense Mutation	AAG,GAG	K10E	NP_001289888.1
NM_001302960.1	335	Missense Mutation	AAG,GAG	K69E	NP_001289889.1
NM_003977.3	335	Missense Mutation	AAG,GAG	K69E	NP_003968.3

Gene: MIR6752
Gene Name: microRNA 6752

There are no transcripts associated with this gene.

Gene: PITPNM1
Gene Name: phosphatidylinositol transfer protein membrane associated 1

There are no transcripts associated with this gene.

View Full Product Details