Product Details

SNP ID: rs138915039
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:4736617 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCTCAAGGCTGTCAAAGACCAGCTC[C/T]CGTCTCTGGACTCAGACTCCCCTTT
Phenotype
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: ANKS3 PubMed Links

Gene Details

Gene: ANKS3
Gene Name: ankyrin repeat and sterile alpha motif domain containing 3

There are no transcripts associated with this gene.

Gene: C16orf71
Gene Name: chromosome 16 open reading frame 71

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_139170.2	183	Missense Mutation	CCG,TCG	P35S	NP_631909.2
XM_005255144.3	183	Intron			XP_005255201.1
XM_017022975.1	183	Missense Mutation	CCG,TCG	P58S	XP_016878464.1
XM_017022976.1	183	Missense Mutation	CCG,TCG	P35S	XP_016878465.1

Gene: ZNF500
Gene Name: zinc finger protein 500

There are no transcripts associated with this gene.

View Full Product Details