Product Details
- SNP ID
-
rs148977203
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.16:798803 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- TCAGGAAGGGGTCCTTGGGGATCCC[A/G]TCCTCGATCCACTTCAGCAGCCTGC
- Phenotype
-
MIM: 613201
MIM: 607298
- Polymorphism
- A/G, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
CHTF18
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs36073541] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- CHTF18
- Gene Name
- chromosome transmission fidelity factor 18
- Gene
- GNG13
- Gene Name
- G protein subunit gamma 13
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_016541.2 |
222 |
Silent Mutation |
|
|
NP_057625.1 |
- Gene
- PRR25
- Gene Name
- proline rich 25
There are no transcripts associated with this gene.
View Full Product Details