Product Details

SNP ID: rs144085775
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:28617245 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AAAAAGACTTGCCTTATAGACAGCA[C/T]TGGGGAGGAGGTTGTTCATGGTAAA
Phenotype: MIM: 610664
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: KIAA0100 PubMed Links

Gene Details

Gene: KIAA0100
Gene Name: KIAA0100

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_014680.3	6000	Missense Mutation	AAT,AGT	N1966S	NP_055495.2
XM_005258073.2	6000	Missense Mutation	AAT,AGT	N1965S	XP_005258130.1
XM_017025423.1	6000	Missense Mutation	AAT,AGT	N1823S	XP_016880912.1

Gene: SGK494
Gene Name: uncharacterized serine/threonine-protein kinase SgK494

There are no transcripts associated with this gene.

Gene: SPAG5-AS1
Gene Name: SPAG5 antisense RNA 1

There are no transcripts associated with this gene.

View Full Product Details