Product Details

SNP ID: rs145164915
Assay Type: Functionally Tested
NCBI dbSNP Submissions: NA
Location: Chr.17:40794000 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGCCTGGATCTGCGCCAGCTGCGTA[C/T]AGTAGTTGCTCTCGGTCTCTGTCAA
Phenotype: MIM: 616677
Polymorphism: C/T, Transition Substitution
Allele Nomenclature
Literature Links: KRT28 PubMed Links
Additional Information: For this assay, SNP(s) [rs2270154] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_181535.3	1091	Missense Mutation	TAT,TGT	Y342C	NP_853513.2