Product Details
- SNP ID
-
rs140942340
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.19:9102570 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- TCCACTTGCTGATGGCATTCTCAAA[A/G]CACAGGAGGTGATCTGAGTGTAAGA
- Phenotype
-
- Polymorphism
- A/G, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
OR1M1
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs12610094] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- OR1M1
- Gene Name
- olfactory receptor family 1 subfamily M member 1
There are no transcripts associated with this gene.
- Gene
- OR7G2
- Gene Name
- olfactory receptor family 7 subfamily G member 2
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_001005193.1 |
737 |
Missense Mutation |
GCT,GTT |
A246V |
NP_001005193.1 |
View Full Product Details