Product Details

SNP ID

rs142171881

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.19:43913930 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

GACTGAAGGCCTTACCACACCTCTC[A/G]CATTTATAGGGTTTCTCTCCTGTGT

Phenotype

MIM: 194554

Polymorphism

A/G, Transition Substitution

Allele Nomenclature

Literature Links

ZNF45 PubMed Links

Additional Information

For this assay, SNP(s) [rs407731] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

ZNF45

Gene Name

zinc finger protein 45

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_003425.3	2660	Silent Mutation			NP_003416.1
XM_011527267.1	2660	Silent Mutation			XP_011525569.1
XM_011527269.1	2660	Silent Mutation			XP_011525571.1
XM_011527271.1	2660	Silent Mutation			XP_011525573.1
XM_011527273.1	2660	Silent Mutation			XP_011525575.1
XM_017027217.1	2660	Silent Mutation			XP_016882706.1
XM_017027218.1	2660	Silent Mutation			XP_016882707.1
XM_017027219.1	2660	Silent Mutation			XP_016882708.1
XM_017027220.1	2660	Silent Mutation			XP_016882709.1
XM_017027221.1	2660	Silent Mutation			XP_016882710.1
XM_017027222.1	2660	Silent Mutation			XP_016882711.1
XM_017027223.1	2660	Silent Mutation			XP_016882712.1
XM_017027224.1	2660	Silent Mutation			XP_016882713.1
XM_017027225.1	2660	Silent Mutation			XP_016882714.1
XM_017027226.1	2660	Silent Mutation			XP_016882715.1
XM_017027227.1	2660	Silent Mutation			XP_016882716.1
XM_017027228.1	2660	Silent Mutation			XP_016882717.1
XM_017027229.1	2660	Silent Mutation			XP_016882718.1
XM_017027230.1	2660	Nonsense Mutation			XP_016882719.1

View Full Product Details