Product Details

SNP ID
rs142037382
Assay Type
Functionally tested
NCBI dbSNP Submissions
NA
Location
Chr.3:49109036 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
CCACCAAAGCCGCCACGGTGCCCAG[C/G]ACAAAGTACCGGAGGCAGCCCTCAT
Phenotype
MIM: 603727 MIM: 614471
Polymorphism
C/G, Transversion substitution
Allele Nomenclature
Literature Links
MIR6890 PubMed Links

Gene Details

Gene
MIR6890
Gene Name
microRNA 6890
There are no transcripts associated with this gene.

Gene
QARS
Gene Name
glutaminyl-tRNA synthetase
There are no transcripts associated with this gene.

Gene
USP19
Gene Name
ubiquitin specific peptidase 19
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001199160.1 4422 Silent Mutation GTC,GTG V1394V NP_001186089.1
NM_001199161.1 4422 Intron NP_001186090.1
NM_001199162.1 4422 Intron NP_001186091.1
NM_006677.2 4422 Silent Mutation GTC,GTG V1293V NP_006668.1
XM_005264823.2 4422 Silent Mutation GTC,GTG V1398V XP_005264880.1
XM_005264824.2 4422 Silent Mutation GTC,GTG V1398V XP_005264881.1
XM_005264825.2 4422 Silent Mutation GTC,GTG V1396V XP_005264882.1
XM_005264826.2 4422 Silent Mutation GTC,GTG V1396V XP_005264883.1
XM_005264827.2 4422 Silent Mutation GTC,GTG V1383V XP_005264884.1
XM_005264829.2 4422 Intron XP_005264886.1
XM_005264830.2 4422 Silent Mutation GTC,GTG V1297V XP_005264887.1
XM_005264831.2 4422 Intron XP_005264888.1
XM_006712946.2 4422 Silent Mutation GTC,GTG V1397V XP_006713009.1
XM_006712947.2 4422 Silent Mutation GTC,GTG V1380V XP_006713010.1
XM_006712948.2 4422 Intron XP_006713011.1
XM_006712949.2 4422 Silent Mutation GTC,GTG V1348V XP_006713012.1
XM_006712950.2 4422 Intron XP_006713013.1
XM_006712951.2 4422 Intron XP_006713014.1
XM_006712952.2 4422 Intron XP_006713015.1
XM_006712953.1 4422 Silent Mutation GTC,GTG V1379V XP_006713016.1
XM_017005615.1 4422 Silent Mutation GTC,GTG V1395V XP_016861104.1
XM_017005616.1 4422 Silent Mutation GTC,GTG V1393V XP_016861105.1
XM_017005617.1 4422 Silent Mutation GTC,GTG V1381V XP_016861106.1
XM_017005618.1 4422 Intron XP_016861107.1
XM_017005619.1 4422 Intron XP_016861108.1
XM_017005620.1 4422 Intron XP_016861109.1
XM_017005621.1 4422 Silent Mutation GTC,GTG V1346V XP_016861110.1
XM_017005622.1 4422 Intron XP_016861111.1
XM_017005623.1 4422 Silent Mutation GTC,GTG V1344V XP_016861112.1
XM_017005624.1 4422 Intron XP_016861113.1
XM_017005625.1 4422 Silent Mutation GTC,GTG V1295V XP_016861114.1
XM_017005626.1 4422 Silent Mutation GTC,GTG V1293V XP_016861115.1
XM_017005627.1 4422 Silent Mutation GTC,GTG V1282V XP_016861116.1
XM_017005628.1 4422 Silent Mutation GTC,GTG V1280V XP_016861117.1
XM_017005629.1 4422 Silent Mutation GTC,GTG V1278V XP_016861118.1
XM_017005630.1 4422 Intron XP_016861119.1
XM_017005631.1 4422 Intron XP_016861120.1
XM_017005632.1 4422 Intron XP_016861121.1
XM_017005633.1 4422 Intron XP_016861122.1
XM_017005634.1 4422 Intron XP_016861123.1
XM_017005635.1 4422 Silent Mutation GTC,GTG V846V XP_016861124.1

View Full Product Details