Product Details

SNP ID: rs139945722
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.5:179798434 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGGGCCTCCTTGTCTGACTGAGGGT[G/T]CTGGGGGCAGAATCAAGGGCTGAGG
Phenotype: MIM: 246530 MIM: 604561 MIM: 601530
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: LTC4S PubMed Links

Gene Details

Gene: LTC4S
Gene Name: leukotriene C4 synthase

There are no transcripts associated with this gene.

Gene: MGAT4B
Gene Name: mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme B

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_014275.4	1618	Missense Mutation	AAC,CAC	N475H	NP_055090.1
NM_054013.3	1618	Missense Mutation	AAC,CAC	N490H	NP_463459.1
XM_017008998.1	1618	Missense Mutation	AAC,CAC	N475H	XP_016864487.1

Gene: MIR1229
Gene Name: microRNA 1229

There are no transcripts associated with this gene.

Gene: SQSTM1
Gene Name: sequestosome 1

There are no transcripts associated with this gene.

View Full Product Details