Product Details

SNP ID: rs115378539
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.8:144353985 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGCTGAGCGCCAGGCGCACGTAGAC[C/G]AGATGCAAGGGGCCCTGGCACACGG
Phenotype: MIM: 609076 MIM: 607882
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: FBXL6 PubMed Links

Gene Details

Gene: FBXL6
Gene Name: F-box and leucine rich repeat protein 6

There are no transcripts associated with this gene.

Gene: SLC52A2
Gene Name: solute carrier family 52 member 2

There are no transcripts associated with this gene.

Gene: TMEM249
Gene Name: transmembrane protein 249

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001252402.2	575	Silent Mutation	CTC,CTG	L137L	NP_001239331.1
NM_001252404.2	575	Missense Mutation	CGT,GGT	R106G	NP_001239333.1
NM_001280561.1	575	Silent Mutation	CTC,CTG	L137L	NP_001267490.1

View Full Product Details