Product Details

SNP ID: rs201579707
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.15:90241025 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ATGGGCAGAAGGATCTCATGGCAGA[A/T]GGGATTCAGTGGCCAAGGAATGCAC
Phenotype: MIM: 602293
Polymorphism: A/T, Transversion substitution
Allele Nomenclature
Literature Links: CIB1 PubMed Links

Gene Details

Gene: CIB1
Gene Name: calcium and integrin binding 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001277764.1	296	Intron			NP_001264693.1
NM_006384.3	296	Intron			NP_006375.2
XM_006720375.1	296	Intron			XP_006720438.1

Gene: GDPGP1
Gene Name: GDP-D-glucose phosphorylase 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001013657.2	296	Missense Mutation	GAA,GAT	E39D	NP_001013679.2
NM_001322811.1	296	Missense Mutation	GAA,GAT	E39D	NP_001309740.1

Gene: TTLL13P
Gene Name: tubulin tyrosine ligase like 13, pseudogene

There are no transcripts associated with this gene.

View Full Product Details