Product Details

SNP ID: rs200336110
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:28615763 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGTACTCCAGACAGGGCAGCACCAG[A/G]TTAAGGTCACCCCAGTCCACACTGT
Phenotype: MIM: 610664
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: KIAA0100 PubMed Links

Gene Details

Gene: KIAA0100
Gene Name: KIAA0100

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_014680.3	6529	Silent Mutation	AAC,AAT	N2142N	NP_055495.2
XM_005258073.2	6529	Silent Mutation	AAC,AAT	N2141N	XP_005258130.1
XM_017025423.1	6529	Silent Mutation	AAC,AAT	N1999N	XP_016880912.1

Gene: SGK494
Gene Name: uncharacterized serine/threonine-protein kinase SgK494

There are no transcripts associated with this gene.

Gene: SPAG5-AS1
Gene Name: SPAG5 antisense RNA 1

There are no transcripts associated with this gene.

View Full Product Details