Product Details

SNP ID: rs199553372
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:7910571 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CAGTGCTTTGGGACGTTCATCACCA[A/G]CGTGAGTACCTGGCCGCGCCCTGCA
Phenotype: MIM: 612891 MIM: 603014 MIM: 605076
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: LRRC8E PubMed Links

Gene Details

Gene: LRRC8E
Gene Name: leucine rich repeat containing 8 family member E

There are no transcripts associated with this gene.

Gene: MAP2K7
Gene Name: mitogen-activated protein kinase kinase 7

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001297555.1	779	Missense Mutation	AAC,AGC	N205S	NP_001284484.1
NM_001297556.1	779	Missense Mutation	AAC,AGC	N189S	NP_001284485.1
NM_145185.3	779	Missense Mutation	AAC,AGC	N189S	NP_660186.1
XM_006722800.2	779	Missense Mutation	AAC,AGC	N205S	XP_006722863.1

Gene: SNAPC2
Gene Name: small nuclear RNA activating complex polypeptide 2

There are no transcripts associated with this gene.

Gene: TGFBR3L
Gene Name: transforming growth factor beta receptor 3 like

There are no transcripts associated with this gene.

View Full Product Details