Product Details
- SNP ID
-
rs201135902
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.19:53258430 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- TGCTTTGTATCCAATAAATATCAGC[A/G]CAGCCTGGCATTTGGGGCCACTACC
- Phenotype
-
- Polymorphism
- A/G, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
VN1R2
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs2965249] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- VN1R2
- Gene Name
- vomeronasal 1 receptor 2
| Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
| NM_173856.2 |
139 |
Missense Mutation |
ACA,GCA |
T19A |
NP_776255.2 |
- Gene
- VN1R4
- Gene Name
- vomeronasal 1 receptor 4
There are no transcripts associated with this gene.
- Gene
- ZNF677
- Gene Name
- zinc finger protein 677
There are no transcripts associated with this gene.
View Full Product Details