Product Details

SNP ID
rs201653966
Assay Type
Functionally Tested
NCBI dbSNP Submissions
NA
Location
Chr.8:47260965 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
TCAGGCGGCGCTCCCGGAGATGCCC[A/C]GCGGCAGCCGCGCTCGGGGCTCTAA
Phenotype
MIM: 615384
Polymorphism
A/C, Transversion Substitution
Allele Nomenclature
Literature Links
SPIDR PubMed Links
Additional Information
For this assay, SNP(s) [rs192114624] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
SPIDR
Gene Name
scaffolding protein involved in DNA repair
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001080394.3 30 Missense Mutation AGC,CGC S3R NP_001073863.1
NM_001282916.1 30 UTR 5 NP_001269845.1
NM_001282919.1 30 UTR 5 NP_001269848.1
XM_005251189.3 30 Missense Mutation AGC,CGC S3R XP_005251246.1
XM_005251191.3 30 Missense Mutation AGC,CGC S3R XP_005251248.1
XM_005251193.3 30 Missense Mutation AGC,CGC S3R XP_005251250.1
XM_005251195.4 30 UTR 5 XP_005251252.1
XM_005251198.4 30 UTR 5 XP_005251255.1
XM_005251199.4 30 Intron XP_005251256.1
XM_006716443.3 30 UTR 5 XP_006716506.1
XM_006716444.3 30 UTR 5 XP_006716507.1
XM_011517497.2 30 Missense Mutation AGC,CGC S3R XP_011515799.1
XM_011517500.2 30 Missense Mutation AGC,CGC S3R XP_011515802.1
XM_011517507.2 30 Intron XP_011515809.1
XM_017013268.1 30 Missense Mutation AGC,CGC S3R XP_016868757.1
XM_017013269.1 30 Missense Mutation AGC,CGC S3R XP_016868758.1
XM_017013270.1 30 Missense Mutation AGC,CGC S3R XP_016868759.1
XM_017013271.1 30 Intron XP_016868760.1
XM_017013272.1 30 Intron XP_016868761.1
XM_017013273.1 30 Missense Mutation AGC,CGC S3R XP_016868762.1
XM_017013274.1 30 UTR 5 XP_016868763.1
XM_017013275.1 30 Intron XP_016868764.1
XM_017013276.1 30 Intron XP_016868765.1
XM_017013277.1 30 UTR 5 XP_016868766.1
XM_017013278.1 30 UTR 5 XP_016868767.1
XM_017013279.1 30 Intron XP_016868768.1
XM_017013280.1 30 UTR 5 XP_016868769.1
XM_017013281.1 30 UTR 5 XP_016868770.1
XM_017013282.1 30 UTR 5 XP_016868771.1
XM_017013283.1 30 Intron XP_016868772.1
XM_017013284.1 30 UTR 5 XP_016868773.1
XM_017013285.1 30 UTR 5 XP_016868774.1
XM_017013286.1 30 Intron XP_016868775.1
XM_017013287.1 30 UTR 5 XP_016868776.1
XM_017013288.1 30 Intron XP_016868777.1
XM_017013289.1 30 Intron XP_016868778.1
XM_017013290.1 30 Intron XP_016868779.1
XM_017013291.1 30 Intron XP_016868780.1

View Full Product Details