Product Details

SNP ID

rs17118135

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.12:55939426 on Build GRCh38

Set Membership

HapMap

Context Sequence [VIC/FAM]

CTGTGCCTTCCTAGACTCTGAAGGA[C/T]GACGGACAGCACATGTGGAGGCCCA

Phenotype

MIM: 125855

Polymorphism

C/T, Transition Substitution

Allele Nomenclature

Literature Links

DGKA PubMed Links

Additional Information

For this assay, SNP(s) [rs113515918] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

DGKA

Gene Name

diacylglycerol kinase alpha

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001345.4	701	Silent Mutation	GAC,GAT	D202D	NP_001336.2
NM_201444.2	701	Silent Mutation	GAC,GAT	D202D	NP_958852.1
NM_201445.1	701	Silent Mutation	GAC,GAT	D202D	NP_958853.1
NM_201554.1	701	Silent Mutation	GAC,GAT	D202D	NP_963848.1
XM_005268688.2	701	Silent Mutation	GAC,GAT	D240D	XP_005268745.1
XM_005268689.2	701	Silent Mutation	GAC,GAT	D90D	XP_005268746.1
XM_005268690.2	701	Silent Mutation	GAC,GAT	D90D	XP_005268747.1
XM_011537991.2	701	Silent Mutation	GAC,GAT	D202D	XP_011536293.1
XM_011537993.2	701	Silent Mutation	GAC,GAT	D202D	XP_011536295.1
XM_011537995.2	701	Silent Mutation	GAC,GAT	D90D	XP_011536297.1
XM_017018900.1	701	Silent Mutation	GAC,GAT	D358D	XP_016874389.1
XM_017018901.1	701	Silent Mutation	GAC,GAT	D320D	XP_016874390.1
XM_017018902.1	701	Silent Mutation	GAC,GAT	D320D	XP_016874391.1
XM_017018903.1	701	Silent Mutation	GAC,GAT	D320D	XP_016874392.1
XM_017018904.1	701	Silent Mutation	GAC,GAT	D320D	XP_016874393.1
XM_017018905.1	701	Silent Mutation	GAC,GAT	D320D	XP_016874394.1
XM_017018906.1	701	Silent Mutation	GAC,GAT	D320D	XP_016874395.1
XM_017018907.1	701	Silent Mutation	GAC,GAT	D320D	XP_016874396.1
XM_017018908.1	701	Silent Mutation	GAC,GAT	D286D	XP_016874397.1
XM_017018909.1	701	Silent Mutation	GAC,GAT	D61D	XP_016874398.1

View Full Product Details