Product Details

SNP ID: rs149890387
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.2:24077554 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TGCTCTGGAAAGGCCTGGGGTGGCC[A/G]CGTCCTGTCCTGCCCCATCCTCCTT
Phenotype: MIM: 600620 MIM: 607835 MIM: 605171
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: FAM228B PubMed Links

Gene Details

Gene: FAM228B
Gene Name: family with sequence similarity 228 member B

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001145710.1	1514	Intron			NP_001139182.1
NM_001291328.1	1514	Intron			NP_001278257.1

Gene: FKBP1B
Gene Name: FK506 binding protein 1B

There are no transcripts associated with this gene.

Gene: SF3B6
Gene Name: splicing factor 3b subunit 6

There are no transcripts associated with this gene.

Gene: TP53I3
Gene Name: tumor protein p53 inducible protein 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001206802.2	1514	UTR 3			NP_001193731.1
NM_004881.4	1514	UTR 3			NP_004872.2
NM_147184.3	1514	UTR 3			NP_671713.1
XM_005264650.2	1514	UTR 3			XP_005264707.1
XM_006712150.2	1514	UTR 3			XP_006712213.1

View Full Product Details