Product Details

SNP ID: rs1112463
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:89204253 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: TTGCTTCTAAGAGTGTTATAAGTTA[A/T]GGTCTTACATTAAGGTATTTGATCC
Phenotype: MIM: 114019
Polymorphism: A/T, Transversion substitution
Allele Nomenclature
Literature Links: CDH15 PubMed Links

Gene Details

Gene: CDH15
Gene Name: cadherin 15

There are no transcripts associated with this gene.

Gene: SLC22A31
Gene Name: solute carrier family 22 member 31

There are no transcripts associated with this gene.

Gene: ZNF778
Gene Name: zinc finger protein 778

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001201407.1		Intron			NP_001188336.1
NM_182531.3		Intron			NP_872337.2
XM_005256288.2		Intron			XP_005256345.1
XM_011522940.2		Intron			XP_011521242.1
XM_017023015.1		Intron			XP_016878504.1
XM_017023016.1		Intron			XP_016878505.1
XM_017023017.1		Intron			XP_016878506.1

View Full Product Details