Product Details

SNP ID: rs941288
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.7:100179185 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: TAATTATGAGTTAAATTCCCTTGCA[A/G]CAGGCAGTTTACACTTCTGAAGCCT
Phenotype: MIM: 608489
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: GATS PubMed Links

Gene Details

Gene: GATS
Gene Name: GATS, stromal antigen 3 opposite strand

There are no transcripts associated with this gene.

Gene: GPC2
Gene Name: glypican 2

There are no transcripts associated with this gene.

Gene: STAG3
Gene Name: stromal antigen 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001282716.1		Intron			NP_001269645.1
NM_001282717.1		Intron			NP_001269646.1
NM_001282718.1		Intron			NP_001269647.1
NM_012447.3		Intron			NP_036579.2
XM_011515742.1		Intron			XP_011514044.1
XM_017011683.1		Intron			XP_016867172.1
XM_017011684.1		Intron			XP_016867173.1
XM_017011685.1		Intron			XP_016867174.1
XM_017011686.1		Intron			XP_016867175.1
XM_017011687.1		Intron			XP_016867176.1

View Full Product Details