Product Details

SNP ID: rs3802168
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.8:11769945 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GAGGCCCCCACTGACCCTCAGACCC[A/G]CGTCTGCGCCCCTCTCCCCGCACCC
Phenotype: MIM: 600576 MIM: 608933
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: C8orf49 PubMed Links

Gene Details

Gene: C8orf49
Gene Name: chromosome 8 open reading frame 49

There are no transcripts associated with this gene.

Gene: GATA4
Gene Name: GATA binding protein 4

There are no transcripts associated with this gene.

Gene: NEIL2
Gene Name: nei like DNA glycosylase 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001135746.1	283	Intron			NP_001129218.1
NM_001135747.1	283	Intron			NP_001129219.1
NM_001135748.1	283	Intron			NP_001129220.1
NM_145043.2	283	UTR 5			NP_659480.1
XM_005272382.2	283	Intron			XP_005272439.1
XM_005272383.2	283	UTR 5			XP_005272440.1
XM_017013301.1	283	UTR 5			XP_016868790.1

View Full Product Details