Product Details

SNP ID
rs3736923
Assay Type
Functionally Tested
NCBI dbSNP Submissions
NA
Location
Chr.10:103090812 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
TCTAAAACAAAGAACAAGATTGATT[C/T]TTGGCTCATTCAACAAATATTTATT
Phenotype
MIM: 607803 MIM: 600417
Polymorphism
C/T, Transition Substitution
Allele Nomenclature
Literature Links
CNNM2 PubMed Links
Additional Information
For this assay, SNP(s) [rs3736924] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
CNNM2
Gene Name
cyclin and CBS domain divalent metal cation transport mediator 2
There are no transcripts associated with this gene.

Gene
NT5C2
Gene Name
5'-nucleotidase, cytosolic II
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001134373.2 Intron NP_001127845.1
NM_012229.4 Intron NP_036361.1
XM_005269632.4 Intron XP_005269689.1
XM_005269633.4 Intron XP_005269690.1
XM_005269634.4 Intron XP_005269691.1
XM_005269635.4 Intron XP_005269692.1
XM_005269636.4 Intron XP_005269693.1
XM_005269637.4 Intron XP_005269694.1
XM_005269638.4 Intron XP_005269695.1
XM_005269639.4 Intron XP_005269696.1
XM_005269640.4 Intron XP_005269697.1
XM_005269641.4 Intron XP_005269698.1
XM_005269642.4 Intron XP_005269699.1
XM_005269643.4 Intron XP_005269700.1
XM_005269644.4 Intron XP_005269701.1
XM_005269645.4 Intron XP_005269702.1
XM_005269646.4 Intron XP_005269703.1
XM_006717721.3 Intron XP_006717784.1
XM_006717723.3 Intron XP_006717786.1
XM_011539537.2 Intron XP_011537839.1
XM_017015947.1 Intron XP_016871436.1
XM_017015948.1 Intron XP_016871437.1
XM_017015949.1 Intron XP_016871438.1
XM_017015950.1 Intron XP_016871439.1
XM_017015951.1 Intron XP_016871440.1
XM_017015952.1 Intron XP_016871441.1
XM_017015953.1 Intron XP_016871442.1
XM_017015954.1 Intron XP_016871443.1
XM_017015955.1 Intron XP_016871444.1
XM_017015956.1 Intron XP_016871445.1
XM_017015957.1 Intron XP_016871446.1
XM_017015958.1 Intron XP_016871447.1
XM_017015959.1 Intron XP_016871448.1
XM_017015960.1 Intron XP_016871449.1
XM_017015961.1 Intron XP_016871450.1
XM_017015962.1 Intron XP_016871451.1
XM_017015963.1 Intron XP_016871452.1
XM_017015964.1 Intron XP_016871453.1
XM_017015965.1 Intron XP_016871454.1
XM_017015966.1 Intron XP_016871455.1
XM_017015967.1 Intron XP_016871456.1
XM_017015968.1 Intron XP_016871457.1
XM_017015969.1 Intron XP_016871458.1
XM_017015970.1 Intron XP_016871459.1
XM_017015971.1 Intron XP_016871460.1
XM_017015972.1 Intron XP_016871461.1
XM_017015973.1 Intron XP_016871462.1
XM_017015974.1 Intron XP_016871463.1
XM_017015975.1 Intron XP_016871464.1
XM_017015976.1 Intron XP_016871465.1

View Full Product Details