Product Details

SNP ID: rs73366214
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:82235705 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GTCGGGGGCTGCTTGTCCCAGGAGG[C/T]AATCTGAGTCCTGGCCGAGCCCAAA
Phenotype: MIM: 600864 MIM: 603877
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: CSNK1D PubMed Links

Gene Details

Gene: CSNK1D
Gene Name: casein kinase 1 delta

There are no transcripts associated with this gene.

Gene: MIR6787
Gene Name: microRNA 6787

There are no transcripts associated with this gene.

Gene: SLC16A3
Gene Name: solute carrier family 16 member 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001042422.2		Intron			NP_001035887.1
NM_001042423.2		Intron			NP_001035888.1
NM_001206950.1		Intron			NP_001193879.1
NM_001206951.1		Intron			NP_001193880.1
NM_001206952.1		Intron			NP_001193881.1
NM_004207.3		Intron			NP_004198.1
XM_011523607.1		Intron			XP_011521909.1

View Full Product Details