Product Details

SNP ID: rs7509516
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.20:59935447 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TTTTTAAAGGTTTTAGACCGTGGCA[A/T]TTCATGAAAAACCTTCTCAATTATA
Phenotype: MIM: 603326 MIM: 604105
Polymorphism: A/T, Transversion substitution
Allele Nomenclature
Literature Links: FAM217B PubMed Links

Gene Details

Gene: FAM217B
Gene Name: family with sequence similarity 217 member B

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001190826.1		Intron			NP_001177755.1
NM_001190827.1		Intron			NP_001177756.1
NM_022106.2		Intron			NP_071389.1
XM_011528985.2		Intron			XP_011527287.1
XM_011528986.2		Intron			XP_011527288.1

Gene: PPP1R3D
Gene Name: protein phosphatase 1 regulatory subunit 3D

There are no transcripts associated with this gene.

Gene: SYCP2
Gene Name: synaptonemal complex protein 2

There are no transcripts associated with this gene.

View Full Product Details