Product Details

SNP ID: rs10467890
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.14:103930699 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GCTGTTTGTATGTTTGCACACTTTA[C/T]TTCCTTGAGCTACTCTGGTAAATGA
Phenotype: MIM: 604573
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: C14orf2 PubMed Links

Gene Details

Gene: C14orf2
Gene Name: chromosome 14 open reading frame 2

There are no transcripts associated with this gene.

Gene: RD3L
Gene Name: retinal degeneration 3-like

There are no transcripts associated with this gene.

Gene: TDRD9
Gene Name: tudor domain containing 9

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_153046.2		Intron			NP_694591.2
XM_005267309.3		Intron			XP_005267366.1
XM_006720019.3		Intron			XP_006720082.1
XM_006720020.3		Intron			XP_006720083.1
XM_011536397.2		Intron			XP_011534699.1
XM_011536398.2		Intron			XP_011534700.1
XM_011536400.2		Intron			XP_011534702.1
XM_011536401.2		Intron			XP_011534703.1
XM_011536402.2		Intron			XP_011534704.1
XM_017020955.1		Intron			XP_016876444.1

View Full Product Details