Product Details

SNP ID: rs12595504
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.15:34345997 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: ATTCTGGAGGCTTCCAGACAGCCAC[A/G]GTTAGTGCCCAAACCTGAGAGGATG
Phenotype: MIM: 606471 MIM: 608963 MIM: 604878
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: NOP10 PubMed Links

Gene Details

Gene: NOP10
Gene Name: NOP10 ribonucleoprotein

There are no transcripts associated with this gene.

Gene: NUTM1
Gene Name: NUT midline carcinoma family member 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001284292.1	444	Missense Mutation	CAG,CGG	Q21R	NP_001271221.1
NM_001284293.1	444	Intron			NP_001271222.1
NM_175741.2	444	UTR 5			NP_786883.1

Gene: SLC12A6
Gene Name: solute carrier family 12 member 6

There are no transcripts associated with this gene.

View Full Product Details