Product Details

SNP ID: rs17150369
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.7:88210375 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: TGATTATAAGGAAATAGCGTTGCCA[C/T]TGTGAACCACTTATAAAAAGCGGTC
Phenotype: MIM: 603709 MIM: 182520
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: ADAM22 PubMed Links

Gene Details

Gene: ADAM22
Gene Name: ADAM metallopeptidase domain 22

There are no transcripts associated with this gene.

Gene: LOC102723885
Gene Name: uncharacterized LOC102723885

There are no transcripts associated with this gene.

Gene: SRI
Gene Name: sorcin

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001256891.1		Intron			NP_001243820.1
NM_001256892.1		Intron			NP_001243821.1
NM_003130.3		Intron			NP_003121.1
NM_198901.1		Intron			NP_944490.1
XM_011516528.1		Intron			XP_011514830.1

View Full Product Details