Product Details
- SNP ID
-
rs41265393
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.6:169702954 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- GCCAGAAGCACGCTGGTGCCCCGGA[A/G]GACGCCTCGCAAGAGGAGGAATCTG
- Phenotype
-
MIM: 616987
MIM: 613069
- Polymorphism
- A/G, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
C6orf120
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs150288859] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- C6orf120
- Gene Name
- chromosome 6 open reading frame 120
- Gene
- PHF10
- Gene Name
- PHD finger protein 10
- Gene
- WDR27
- Gene Name
- WD repeat domain 27
View Full Product Details