Product Details
- SNP ID
-
rs55797273
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.17:3923928 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- ACCAAACAGCAGGTCAGCAGGTGGG[C/T]ACAGGGCCCGCTCCTGCTAAGACCT
- Phenotype
-
MIM: 601929
MIM: 600845
- Polymorphism
- C/T, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
ATP2A3
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs115103437] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- ATP2A3
- Gene Name
- ATPase sarcoplasmic/endoplasmic reticulum Ca2+ transporting 3
- Gene
- P2RX1
- Gene Name
- purinergic receptor P2X 1
There are no transcripts associated with this gene.
View Full Product Details