Product Details
- SNP ID
-
rs1046321
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.17:35575265 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- TCACAGTATATGGAAGGAGCTTTTT[C/T]CCCCCCCAGAGTGTTTCTAAGCATT
- Phenotype
-
MIM: 601758
- Polymorphism
- C/T, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
LOC105371743
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs147182821] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- LOC105371743
- Gene Name
- uncharacterized LOC105371743
There are no transcripts associated with this gene.
- Gene
- PEX12
- Gene Name
- peroxisomal biogenesis factor 12
| Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
| NM_000286.2 |
2213 |
UTR 3 |
|
|
NP_000277.1 |
- Gene
- SNORD7
- Gene Name
- small nucleolar RNA, C/D box 7
There are no transcripts associated with this gene.
View Full Product Details