Product Details

SNP ID: rs5210
Assay Type: Validated
NCBI dbSNP Submissions: NA
Location: Chr.11:17386704 on Build GRCh38
Set Membership: Validated
Context Sequence [VIC/FAM]: CGGGGGAGAGGGGTGAGCCAGTCCT[A/G]AATTGGGTTGGGAGGAGCAGGGACA
Phenotype: MIM: 600509 MIM: 600937 MIM: 613714
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ABCC8 PubMed Links

Gene Details

Gene: ABCC8
Gene Name: ATP binding cassette subfamily C member 8

There are no transcripts associated with this gene.

Gene: KCNJ11
Gene Name: potassium voltage-gated channel subfamily J member 11

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_000525.3	1585	UTR 3			NP_000516.3
NM_001166290.1	1585	UTR 3			NP_001159762.1
XM_006718226.3	1585	UTR 3			XP_006718289.1
XM_017017680.1	1585	UTR 3			XP_016873169.1

Gene: NCR3LG1
Gene Name: natural killer cell cytotoxicity receptor 3 ligand 1

There are no transcripts associated with this gene.

View Full Product Details