Product Details

SNP ID

rs35748721

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.17:78131657 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

TGCCGGAGCCGGAGGAGCTGTGGGA[A/G]GCAGAGATGGAGCGGCTGCGCGGCT

Phenotype

MIM: 605828 MIM: 605829

Polymorphism

A/G, Transition Substitution

Allele Nomenclature

Literature Links

TMC6 PubMed Links

Additional Information

For this assay, SNP(s) [rs145016347] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

TMC6

Gene Name

transmembrane channel like 6

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001127198.2	1933	Intron			NP_001120670.1
NM_001321185.1	1933	Intron			NP_001308114.1
NM_007267.7	1933	Intron			NP_009198.4
XM_005256995.1	1933	Intron			XP_005257052.1
XM_011524255.1	1933	Intron			XP_011522557.1
XM_011524256.1	1933	Intron			XP_011522558.1
XM_011524257.2	1933	Intron			XP_011522559.1
XM_011524258.1	1933	Intron			XP_011522560.1
XM_017024107.1	1933	Intron			XP_016879596.1
XM_017024108.1	1933	Intron			XP_016879597.1
XM_017024109.1	1933	Intron			XP_016879598.1

Gene

TMC8

Gene Name

transmembrane channel like 8

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_152468.4	1933	Silent Mutation	GAA,GAG	E23E	NP_689681.2
XM_011524402.2	1933	Silent Mutation	GAA,GAG	E23E	XP_011522704.1
XM_011524403.2	1933	Silent Mutation	GAA,GAG	E23E	XP_011522705.1
XM_011524404.2	1933	Silent Mutation	GAA,GAG	E23E	XP_011522706.1
XM_011524406.2	1933	Silent Mutation	GAA,GAG	E23E	XP_011522708.1
XM_011524409.2	1933	Silent Mutation	GAA,GAG	E23E	XP_011522711.1
XM_011524410.2	1933	Silent Mutation	GAA,GAG	E23E	XP_011522712.1
XM_011524411.2	1933	Silent Mutation	GAA,GAG	E23E	XP_011522713.1
XM_017024238.1	1933	Silent Mutation	GAA,GAG	E23E	XP_016879727.1
XM_017024239.1	1933	Silent Mutation	GAA,GAG	E23E	XP_016879728.1
XM_017024240.1	1933	Silent Mutation	GAA,GAG	E23E	XP_016879729.1
XM_017024241.1	1933	Silent Mutation	GAA,GAG	E23E	XP_016879730.1
XM_017024242.1	1933	Intron			XP_016879731.1
XM_017024243.1	1933	Intron			XP_016879732.1
XM_017024244.1	1933	Silent Mutation	GAA,GAG	E23E	XP_016879733.1

View Full Product Details