Product Details

SNP ID: rs1053572
Assay Type: Functionally tested
NCBI dbSNP Submissions: 3
Location: Chr.1:160215998 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTGACTGTCCCAGGATACAGAATTC[C/T]TGGTTGGATCTTGTGGAACTGGGGG
Phenotype: MIM: 615820 MIM: 603434
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: DCAF8 PubMed Links

Gene Details

Gene: DCAF8
Gene Name: DDB1 and CUL4 associated factor 8

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_015726.3	3600	UTR 3			NP_056541.2

Gene: LOC729867
Gene Name: uncharacterized LOC729867

There are no transcripts associated with this gene.

Gene: PEA15
Gene Name: phosphoprotein enriched in astrocytes 15

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001297576.1	3600	Intron			NP_001284505.1
NM_001297577.1	3600	Intron			NP_001284506.1
NM_001297578.1	3600	Intron			NP_001284507.1
NM_003768.4	3600	Intron			NP_003759.1
XM_006711599.2	3600	Intron			XP_006711662.1

View Full Product Details