Product Details

SNP ID

rs12573200

Assay Type

Functionally tested

NCBI dbSNP Submissions

NA

Location

Chr.10:103089098 on Build GRCh38

Set Membership

HapMap

Context Sequence [VIC/FAM]

CCCTAAAGCAACGCAAGTAGAGCAT[A/T]CTTCTGTGCAAAGCCAGTGATAGAG

Phenotype

MIM: 607803 MIM: 600417

Polymorphism

A/T, Transversion substitution

Allele Nomenclature

Literature Links

CNNM2 PubMed Links

Gene Details

Gene

CNNM2

Gene Name

cyclin and CBS domain divalent metal cation transport mediator 2

There are no transcripts associated with this gene.

Gene

NT5C2

Gene Name

5'-nucleotidase, cytosolic II

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001134373.2	2388	UTR 3			NP_001127845.1
NM_012229.4	2388	UTR 3			NP_036361.1
XM_005269632.4	2388	UTR 3			XP_005269689.1
XM_005269633.4	2388	UTR 3			XP_005269690.1
XM_005269634.4	2388	UTR 3			XP_005269691.1
XM_005269635.4	2388	UTR 3			XP_005269692.1
XM_005269636.4	2388	UTR 3			XP_005269693.1
XM_005269637.4	2388	UTR 3			XP_005269694.1
XM_005269638.4	2388	UTR 3			XP_005269695.1
XM_005269639.4	2388	UTR 3			XP_005269696.1
XM_005269640.4	2388	UTR 3			XP_005269697.1
XM_005269641.4	2388	UTR 3			XP_005269698.1
XM_005269642.4	2388	UTR 3			XP_005269699.1
XM_005269643.4	2388	UTR 3			XP_005269700.1
XM_005269644.4	2388	UTR 3			XP_005269701.1
XM_005269645.4	2388	UTR 3			XP_005269702.1
XM_005269646.4	2388	UTR 3			XP_005269703.1
XM_006717721.3	2388	UTR 3			XP_006717784.1
XM_006717723.3	2388	UTR 3			XP_006717786.1
XM_011539537.2	2388	UTR 3			XP_011537839.1
XM_017015947.1	2388	UTR 3			XP_016871436.1
XM_017015948.1	2388	UTR 3			XP_016871437.1
XM_017015949.1	2388	UTR 3			XP_016871438.1
XM_017015950.1	2388	UTR 3			XP_016871439.1
XM_017015951.1	2388	UTR 3			XP_016871440.1
XM_017015952.1	2388	UTR 3			XP_016871441.1
XM_017015953.1	2388	UTR 3			XP_016871442.1
XM_017015954.1	2388	UTR 3			XP_016871443.1
XM_017015955.1	2388	UTR 3			XP_016871444.1
XM_017015956.1	2388	UTR 3			XP_016871445.1
XM_017015957.1	2388	UTR 3			XP_016871446.1
XM_017015958.1	2388	UTR 3			XP_016871447.1
XM_017015959.1	2388	UTR 3			XP_016871448.1
XM_017015960.1	2388	UTR 3			XP_016871449.1
XM_017015961.1	2388	UTR 3			XP_016871450.1
XM_017015962.1	2388	UTR 3			XP_016871451.1
XM_017015963.1	2388	UTR 3			XP_016871452.1
XM_017015964.1	2388	UTR 3			XP_016871453.1
XM_017015965.1	2388	UTR 3			XP_016871454.1
XM_017015966.1	2388	UTR 3			XP_016871455.1
XM_017015967.1	2388	UTR 3			XP_016871456.1
XM_017015968.1	2388	UTR 3			XP_016871457.1
XM_017015969.1	2388	UTR 3			XP_016871458.1
XM_017015970.1	2388	UTR 3			XP_016871459.1
XM_017015971.1	2388	UTR 3			XP_016871460.1
XM_017015972.1	2388	UTR 3			XP_016871461.1
XM_017015973.1	2388	UTR 3			XP_016871462.1
XM_017015974.1	2388	UTR 3			XP_016871463.1
XM_017015975.1	2388	UTR 3			XP_016871464.1
XM_017015976.1	2388	UTR 3			XP_016871465.1

View Full Product Details