Product Details

SNP ID: hCV721702
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.X:50003226 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TACCCTCCCACACCCAAGGCTTGCA[A/G]AAGAGCGAGCCTTCTCTTCCCTCTC
Phenotype: MIM: 300008
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CLCN5 PubMed Links

Gene Details

Gene: CLCN5
Gene Name: chloride voltage-gated channel 5

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_000084.4		Intron			NP_000075.1
NM_001127898.3		Intron			NP_001121370.1
NM_001127899.3		Intron			NP_001121371.1
NM_001272102.1		Intron			NP_001259031.1
NM_001282163.1		Intron			NP_001269092.1

Gene: MIR188
Gene Name: microRNA 188

There are no transcripts associated with this gene.

Gene: MIR362
Gene Name: microRNA 362

There are no transcripts associated with this gene.

Gene: MIR500A
Gene Name: microRNA 500a

There are no transcripts associated with this gene.

Gene: MIR500B
Gene Name: microRNA 500b

There are no transcripts associated with this gene.

Gene: MIR501
Gene Name: microRNA 501

There are no transcripts associated with this gene.

Gene: MIR532
Gene Name: microRNA 532

There are no transcripts associated with this gene.

View Full Product Details