Product Details

SNP ID: rs104894508
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:88810141 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTCCAGGGCGTCTTTCTGAATCTCC[A/G]GCTCAGCCTGGAGTGGGAAGTGGTG
Phenotype: MIM: 102600 MIM: 605525 MIM: 612222
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: APRT PubMed Links

Gene Details

Gene: APRT
Gene Name: adenine phosphoribosyltransferase

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_000485.2	364	Missense Mutation	CCG,CTG	P110L	NP_000476.1
NM_001030018.1	364	Missense Mutation	CCG,CTG	P110L	NP_001025189.1

Gene: CDT1
Gene Name: chromatin licensing and DNA replication factor 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_030928.3	364	Intron			NP_112190.2

Gene: GALNS
Gene Name: galactosamine (N-acetyl)-6-sulfatase

There are no transcripts associated with this gene.

View Full Product Details