Product Details

SNP ID: rs77048088
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.12:6972507 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AACCTTCCAAAACTTGTATTTGTAT[A/G]TAACAGTTTGTTTTTAGACTTTTTA
Phenotype: MIM: 611531 MIM: 611950 MIM: 612093 MIM: 612092 MIM: 610704 MIM: 615642
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: EMG1 PubMed Links

Gene Details

Gene: EMG1
Gene Name: EMG1, N1-specific pseudouridine methyltransferase

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001320049.1		Intron			NP_001306978.1
NM_006331.7		Intron			NP_006322.4

Gene: LOC105369635
Gene Name: uncharacterized LOC105369635

There are no transcripts associated with this gene.

Gene: LPCAT3
Gene Name: lysophosphatidylcholine acyltransferase 3

There are no transcripts associated with this gene.

Gene: MIR141
Gene Name: microRNA 141

There are no transcripts associated with this gene.

Gene: MIR200C
Gene Name: microRNA 200c

There are no transcripts associated with this gene.

Gene: PHB2
Gene Name: prohibitin 2

There are no transcripts associated with this gene.

Gene: SCARNA12
Gene Name: small Cajal body-specific RNA 12

There are no transcripts associated with this gene.

View Full Product Details