Product Details

SNP ID
rs80110211
Assay Type
Functionally Tested
NCBI dbSNP Submissions
NA
Location
Chr.15:49328962 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
CTTCTATTCACATTGAAATAAAGAA[C/T]TATCTAGATGATAATTCAGATAATT
Phenotype
MIM: 137028
Polymorphism
C/T, Transition Substitution
Allele Nomenclature
Literature Links
FAM227B PubMed Links
Additional Information
For this assay, SNP(s) [rs201186301,rs3075142] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
FAM227B
Gene Name
family with sequence similarity 227 member B
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_152647.2 2487 Intron NP_689860.2
XM_005254213.3 2487 Intron XP_005254270.1
XM_005254214.3 2487 Intron XP_005254271.1
XM_005254215.3 2487 Intron XP_005254272.1
XM_005254216.3 2487 Intron XP_005254273.1
XM_005254219.3 2487 Intron XP_005254276.1
XM_005254220.3 2487 Intron XP_005254277.1
XM_006720423.2 2487 Intron XP_006720486.1
XM_006720424.2 2487 Intron XP_006720487.1
XM_006720426.2 2487 Intron XP_006720489.1
XM_006720427.3 2487 Intron XP_006720490.1
XM_011521319.2 2487 Intron XP_011519621.1
XM_011521320.1 2487 Intron XP_011519622.1
XM_011521321.2 2487 Intron XP_011519623.1
XM_011521322.1 2487 Intron XP_011519624.1
XM_011521324.1 2487 Intron XP_011519626.1
XM_011521325.2 2487 Intron XP_011519627.1
XM_011521326.1 2487 Intron XP_011519628.1
XM_017021990.1 2487 Intron XP_016877479.1
XM_017021991.1 2487 Intron XP_016877480.1
XM_017021992.1 2487 Intron XP_016877481.1
XM_017021993.1 2487 Intron XP_016877482.1
XM_017021994.1 2487 Intron XP_016877483.1
XM_017021995.1 2487 Intron XP_016877484.1
XM_017021996.1 2487 Intron XP_016877485.1
Gene
GALK2
Gene Name
galactokinase 2
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001001556.2 2487 UTR 3 NP_001001556.1
NM_001289030.1 2487 UTR 3 NP_001275959.1
NM_001289031.1 2487 UTR 3 NP_001275960.1
NM_002044.3 2487 UTR 3 NP_002035.1
XM_005254279.3 2487 Intron XP_005254336.1
XM_005254280.3 2487 Intron XP_005254337.1
XM_005254284.3 2487 Intron XP_005254341.1
XM_006720461.3 2487 UTR 3 XP_006720524.1
XM_006720462.3 2487 Intron XP_006720525.1
XM_006720463.3 2487 Intron XP_006720526.1
XM_006720464.3 2487 Intron XP_006720527.1
XM_011521441.2 2487 Intron XP_011519743.1
XM_017022062.1 2487 UTR 3 XP_016877551.1
XM_017022063.1 2487 Intron XP_016877552.1
XM_017022064.1 2487 Intron XP_016877553.1
XM_017022065.1 2487 UTR 3 XP_016877554.1
XM_017022066.1 2487 UTR 3 XP_016877555.1

View Full Product Details