Product Details

SNP ID: rs80323556
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:54773630 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGTGACCCTCTGGACATCGTGATCA[C/T]AGGTGAGAGTGTCCAGACTTTCTTC
Phenotype: MIM: 604936
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: KIR2DL1 PubMed Links

Gene Details

Gene: KIR2DL1
Gene Name: killer cell immunoglobulin like receptor, two Ig domains and long cytoplasmic tail 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_014218.2	1011	Missense Mutation	ACA,ATA	T123I	NP_055033.2
XM_011526939.2	1011	Intron			XP_011525241.1
XM_017026782.1	1011	Missense Mutation	ACA,ATA	T70I	XP_016882271.1
XM_017026783.1	1011	Missense Mutation	ACA,ATA	T123I	XP_016882272.1

Gene: LOC101928804
Gene Name: uncharacterized LOC101928804

There are no transcripts associated with this gene.

View Full Product Details